View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_218 (Length: 264)
Name: NF11324A_low_218
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_218 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 219
Target Start/End: Original strand, 52405109 - 52405318
Alignment:
| Q |
10 |
gtgttcatgcggtagatccagcaaaatcggcatttgaagggaaagccagaattcgacgtgctattgaagcggaaggcataccctacacatatgtgtctag |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52405109 |
gtgtccatgcggtagatccagcaaaatctgcatttgaagggaaagccagaattcgacgtgctattgaagcggaaggcataccctacacatatgtgtctag |
52405208 |
T |
|
| Q |
110 |
caactactttgctggatattttctccccacattagctcagccaggacaattcgccccacctccaccaaaagacaaagtcgtcatatatggcgatggaaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52405209 |
caactactttgctggatattttctccccacattagctcagccaggacaattcgccccacctccaccaaaagacaaagtcgtcatatatggcgatggaaat |
52405308 |
T |
|
| Q |
210 |
cccaaaggta |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
52405309 |
cccaaaggta |
52405318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 59 - 131
Target Start/End: Original strand, 52407665 - 52407737
Alignment:
| Q |
59 |
aattcgacgtgctattgaagcggaaggcataccctacacatatgtgtctagcaactactttgctggatatttt |
131 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| |||||||| |||| ||||| ||||||||| |||||| |
|
|
| T |
52407665 |
aattcgacgtatgattgaagctgaaggcataccctatacatatgtatctaccaactcctttgctggctatttt |
52407737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University