View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_237 (Length: 257)
Name: NF11324A_low_237
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_237 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 39372728 - 39372472
Alignment:
| Q |
1 |
gaatgtttatctcaattctcaacgggattgaaccatattattttaattcagttgaaaaatcgtcctaaaaaatttcatatattaaaacggaagatcttac |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39372728 |
gaatgtttatctcaattctcaaccggattgaaccatattattttaatccagttgaaaaatcgtcctaaaaaatttcatatattaaaacggaagatcttac |
39372629 |
T |
 |
| Q |
101 |
accggttaagaaatagacttatgaccttaaaaacatgttaaaaatcagtttttgtactagtagcaagttgagatgttgaagcatttggaagtttctcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39372628 |
accggttaagaaatagacttatgaccttaaaaacatgttaaaaatcagtttttgtactagtagcaagttgagatgttgaagcatttggaagtttctcata |
39372529 |
T |
 |
| Q |
201 |
tgattcttttttaaatnnnnnnnctgccattactatgcattctttataaaactagat |
257 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39372528 |
tgattcttttttaaataaaaaaactgccattactatgcattctttataaaactagat |
39372472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University