View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_242 (Length: 254)
Name: NF11324A_low_242
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_242 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 205
Target Start/End: Complemental strand, 22284750 - 22284554
Alignment:
| Q |
9 |
cattaatcatcatgaaaactacaataagtcaatgttaaaactcttattttcaatacttaatgattagtaatttttgaaaggttaaatacttgctgattaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22284750 |
cattaatcatcatgaaaactacaataagtcaatgttaaaactcttattttcaatacttaatgattagtaatttttgaaaggttaaatacttgctgattaa |
22284651 |
T |
 |
| Q |
109 |
taatttttgaaaggtcacaactcacaaacaagtaaatcacaacgaccttcaaatataaaaaacaaatcatattatgagctaatagaaaacactttcc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22284650 |
taatttttgaaaggtcacaactcacaaacaagtaaatcacaacgaccttcaaatataaaaaacaaatcatattatgagctaatagaaaacactttcc |
22284554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University