View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_244 (Length: 252)
Name: NF11324A_low_244
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_244 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 38643186 - 38643437
Alignment:
| Q |
1 |
gaaatagtgagtagtagtattttagtaattcaacagaaacacaaggcttcttaaatataaatcacatgttaccatagctggcagcatatgaatcctacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643186 |
gaaatagtgagtagtagtattttagtaattcaacaaaaacacaaggcttcttaaatataaatcacatgttaccatagctggcagcatatgaatcctacat |
38643285 |
T |
|
| Q |
101 |
tctcatccactgagcctgtcataaaagctagtacttagttgttagtttgcctctgctagttgccattattcacatttcactcaactcactccaagaataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38643286 |
tctcatccactgagcctgtcataaaagctagtacttagttgttagtttgcctctgctagttgccattattcacatttcactcaactcaccccaagaataa |
38643385 |
T |
|
| Q |
201 |
tggaacatagaagaaactcatcatggtttcttctattctcaactctttcttg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643386 |
tggaacatagaagaaactcatcatggtttcttctattctcaactctttcttg |
38643437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University