View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_254 (Length: 250)
Name: NF11324A_low_254
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_254 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 39372940 - 39372700
Alignment:
| Q |
12 |
atgaataaaaaagacgataaaagaccataacaaacattttgtaaattatagaga--ataaaaagtatactttagccttggtattatatctcaattctctc |
109 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39372940 |
atgaataaaaaagacgataaaagatcataacaaacattttgtaaattatagagagaataaaaagtatactttagccttggtattatatctcaattctctc |
39372841 |
T |
|
| Q |
110 |
tggtttttggcaaaaggcgacataaaataatgtaacacgaagtttatatttgtttctcacaaccaacttaaaatgtaacacaatattgcgttgatgataa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39372840 |
tggtttttggcaaaaggcgacataaaataatgtaacacgaagtttatatttgtttctcacaaccaacttaaaatgtaacacaatattgcgttgatgataa |
39372741 |
T |
|
| Q |
210 |
aaatgttaagatgaatgtttatctcaattctcaaccggatt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39372740 |
aaatgttaagatgaatgtttatctcaattctcaaccggatt |
39372700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University