View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_267 (Length: 250)
Name: NF11324A_low_267
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_267 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 43541096 - 43540864
Alignment:
| Q |
1 |
aataacattatccagctagcatgtcttgaatcttgatcaaacaaaattttcccctttaacatgacattttattccnnnnnnntcaaatagtcttctacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43541096 |
aataacattatccagctagcatgtcttgaatcttgatcaaacagaattttcccctttaacatgacattttattccaaaaaaaataaatagtcttctacaa |
43540997 |
T |
 |
| Q |
101 |
tcttaatatcctaagtttacatatgatattgtggtttgcaagctaaatctacttcctcataactgaaagttaatttttggtttcaaaagcttctttcgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43540996 |
tcttaatatcctaagtttacatatgatattgtggtttgcaagctatatctacttccacataactgaaagttaatttttggtttcaaaagcttctctcgtt |
43540897 |
T |
 |
| Q |
201 |
caacaaattagtcagcttgctccatggacaatt |
233 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
43540896 |
caacaaattaatcagcttgctccatggacaatt |
43540864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University