View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_284 (Length: 247)
Name: NF11324A_low_284
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_284 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 8 - 198
Target Start/End: Complemental strand, 6845997 - 6845811
Alignment:
| Q |
8 |
atggagttgacgcgcttcttgtagtgaggttgggattctgcattttttgagcagaagagtatctgttattacagagaaacatagcttgttcatgaaacac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6845997 |
atggagttgacgcgcttcttgtagtgaggttgtgattctgcattttttgagcagaagagtatctgttattacagagaaacatagcttgttcatgaaacac |
6845898 |
T |
|
| Q |
108 |
ttgtatacgcacgcatgcctcaactaacgccttgtttgtcagggatactaggttgcggctctttgttaagaacaatgggacaattatttat |
198 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6845897 |
ttgcatacgcacgcatgcctcaactaacgcc----ttgtcagggatactaggttgcggctctttgttaagaacaatgggacaattatttat |
6845811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University