View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_290 (Length: 247)
Name: NF11324A_low_290
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_290 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 21 - 236
Target Start/End: Complemental strand, 50386459 - 50386244
Alignment:
| Q |
21 |
aatgtccatatctaatggatacaactctttggttttcaagattcttgtgtagaaggaaattgcttggtctatacttatcttgtcaattttgacatccttc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50386459 |
aatgtccatatctaatggatacaactctttggttttcaagattcttgtgtagaaggaaattgcttggtctatacttatcttgtcaattttgacatccttc |
50386360 |
T |
|
| Q |
121 |
ttagaaatgtggtttgttgggaaactagttggtggatggagaaatatgatgagtgaggtgagattgaaatagttgcatttgttggtgaataggtttttag |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50386359 |
ttagaaatgtggtttgttgggaaactagttggtggatggagaaatatgatgagtgaggtgaaattgaaatagttgcatttgttggtgaataggtttttag |
50386260 |
T |
|
| Q |
221 |
aggcattgttattctt |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
50386259 |
aggcattgttattctt |
50386244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University