View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_295 (Length: 246)
Name: NF11324A_low_295
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_295 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 41983386 - 41983230
Alignment:
| Q |
1 |
atcacatatcagcaatctaaacatagatgttgcatgtttgtgagttggctagcataagtagtgggcaccatgttatccaaatacacacgtttaacaacaa |
100 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41983386 |
atcatatatcattaatctaaacataggtgttgcatgttggtgagttggctagcataagtagtgggcaccatgtcatccaaatacacacgtttaacaacaa |
41983287 |
T |
 |
| Q |
101 |
ttttcaaatgcaactacttccccactatacttacacatctcacctaggagctcaaaa |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41983286 |
ttttcaaatgcaactacttccccactatacttacacatctcacctaggagctcaaaa |
41983230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 152 - 235
Target Start/End: Complemental strand, 41983147 - 41983064
Alignment:
| Q |
152 |
tcaaaaagaataatgcacattctagtttgatttttactataattgagatgagatgagttgatgcaagaatattccttctttcat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41983147 |
tcaaaaagaataatgcacattctagtttgatttttactataattgagatgagatgagttgatgcaagaatattccttctttcat |
41983064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University