View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_298 (Length: 246)
Name: NF11324A_low_298
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_298 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 8 - 222
Target Start/End: Complemental strand, 22421756 - 22421542
Alignment:
| Q |
8 |
ttggtgttgctgtttgtgatgatgaggataatttgatattggaaatttctaaggctgttgttgggaatgaaagtaggaaaattgttgtggagcttatggc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||| | ||||||| ||||||||||||||| |
|
|
| T |
22421756 |
ttggtgttgctgtttgtgatgatgaggataatttgatattggaaatttctaagactgttgatgggaatgagagtcgtaaaattgctgtggagcttatggc |
22421657 |
T |
 |
| Q |
108 |
tttgattgaaggtttcaatgctgttattgctttggatttgaagcgtgttatttattttggtgattattatactcttttttaacatgtgagttcttcttat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
22421656 |
tttgattgaaggtttcaatgctgttattgctttggatttgaagcgtgttatttattttggtgattattatacactttttcaacatgtgagttcttcttac |
22421557 |
T |
 |
| Q |
208 |
tctctctaaatggtt |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
22421556 |
tctctctaaatggtt |
22421542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University