View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_335 (Length: 242)
Name: NF11324A_low_335
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_335 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 43311942 - 43312164
Alignment:
| Q |
1 |
gaaagaggttggtcatcgagccaattagcaatgtcatcagaatcaacaataccattaggctcgggtttggtctcgaggtttaatactggtcccactggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43311942 |
gaaagaggttggtcatcgagccaattaacaatgtcatcagaatcaacaataccattaggctcgggtttggtctcaaggtttaatactggtcccactggat |
43312041 |
T |
|
| Q |
101 |
aaatgggaaaactacgtagacccggatcttctaagaatgagtgaactgcatgagattctagctcatgaaacgaatttactatgaccccacttgctttctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43312042 |
aaatgggaaaactacgtagacccggatcttctaagaatgagtgaactgcatgagattctagctcctgaaacgaatttactatgaccccacttgctttctt |
43312141 |
T |
|
| Q |
201 |
gagtcctctgacatagttaatga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43312142 |
gagtcctctgacatagttaatga |
43312164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 203
Target Start/End: Complemental strand, 39460879 - 39460812
Alignment:
| Q |
136 |
aatgagtgaactgcatgagattctagctcatgaaacgaatttactatgaccccacttgctttcttgag |
203 |
Q |
| |
|
||||| ||||||||||| ||||||||||| | ||| ||||||||||| | ||| ||||||||||||| |
|
|
| T |
39460879 |
aatgattgaactgcatgggattctagctcttcaaatgaatttactataataccatttgctttcttgag |
39460812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University