View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_342 (Length: 241)
Name: NF11324A_low_342
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_342 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 32103470 - 32103698
Alignment:
| Q |
1 |
aagaatatatagtgagtgaggaagaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103470 |
aagaatatatagtgagtgaggaagaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattg |
32103569 |
T |
 |
| Q |
101 |
caccgcagcctgcaacatgttttgaagcttactgcctaatggagatggagccgccattctttattcattcagtcattaccaaacagttttttctttcatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103570 |
caccgcagcctgcaacatgttttgaagcttactgcctaatggagatggagcagccattctttattcattcagtcattaccaaacagttttttctttcatt |
32103669 |
T |
 |
| Q |
201 |
tctctgcaatatttaatcatatctaaaac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32103670 |
tctctgcaatatttaatcatatctaaaac |
32103698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University