View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_347 (Length: 240)
Name: NF11324A_low_347
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_347 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 21 - 240
Target Start/End: Complemental strand, 25196202 - 25195995
Alignment:
| Q |
21 |
actgaactagccgtaaaaataaaacctcgtcgggaaagccgccggagttggcctccgtctaccatcagcaacggtgagatttatcttgataagttcttat |
120 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25196202 |
actgaactggccgtaaaaataaaacctcgtcgggaaagccgccggagttggcctccgtctaccatcagcaacggtgagat------------gttcttat |
25196115 |
T |
|
| Q |
121 |
gaagttagttatatcatttatgttcagtttcacattcaggagccaaaatttattttgataggtttggttgctctcaagtagagttgattctaatattgat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
25196114 |
gaagttagttatatcatttatgttcagtttcacattcaggagccaaaatttattttgataggtttggttgctctcaagtagaattgattctagtattgat |
25196015 |
T |
|
| Q |
221 |
tatttgtctgtttgattctg |
240 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
25196014 |
tatttgtatgtttgattctg |
25195995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 33141849 - 33141805
Alignment:
| Q |
165 |
aaaatttattttgataggtttggttgctctcaagtagagttgatt |
209 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
33141849 |
aaaattgattttgatatgtttggttgctctcaagtataattgatt |
33141805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 214
Target Start/End: Original strand, 38592173 - 38592222
Alignment:
| Q |
165 |
aaaatttattttgataggtttggttgctctcaagtagagttgattctaat |
214 |
Q |
| |
|
|||||| || |||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
38592173 |
aaaattgatattgatatgtttggttgctctcaagtagaattgattctaat |
38592222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 32088715 - 32088671
Alignment:
| Q |
165 |
aaaatttattttgataggtttggttgctctcaagtagagttgatt |
209 |
Q |
| |
|
|||||| ||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
32088715 |
aaaattgattttgacatgtttggttgctctcaagtagaattgatt |
32088671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University