View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_357 (Length: 237)
Name: NF11324A_low_357
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_357 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 22820381 - 22820168
Alignment:
| Q |
17 |
cattaatttgattccctaattttgattatgacattttaactgttgtgagaaaatcattccttacacatttgtgacagttaatgcatcnnnnnnnnnnnng |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22820381 |
cattaatttgattccctaattttgattatgacattttaactgttgtgagaaaatcattccttacacatttgtgacagttaatgcatctttttcttttt-g |
22820283 |
T |
 |
| Q |
117 |
gcacttaatgatattcctaatcctcatccaatatggtggtcgttaatccatttcggattgctccaagcacttattataaggctttcaaatgtttgtactg |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22820282 |
gcacttaatgatattcataatcctcatccaatatggtggt---taatccatttcggattgctccaagcacttattataaggctttcaaatgtttgtactg |
22820186 |
T |
 |
| Q |
217 |
cattgaaattgactccaa |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22820185 |
cattgaaattgactccaa |
22820168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University