View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_366 (Length: 234)
Name: NF11324A_low_366
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_366 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 215
Target Start/End: Original strand, 2442696 - 2442889
Alignment:
| Q |
22 |
gaccgaactctagcttctctttttgcaaccattttcagactatcttgctctgcatgcgatagaatgatacaaaatttctagaattgcattgtaaaatggt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || || | ||||||||||||| |
|
|
| T |
2442696 |
gaccgaactctagcttctctttttgcaaccattttcagactatcttgctctgcgtgcgatagaatgatacaaaatttgtataaattgattgtaaaatggt |
2442795 |
T |
 |
| Q |
122 |
aatatagaggagccctcgatcaacttctggtaaacagtgtcagtgagatgaacttgaaacaaaaacaaggttaacaaactcatatacaaatatt |
215 |
Q |
| |
|
|||||| || ||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2442796 |
aatataaagaagccctcgatcaatttctggtaaacagtgttagtgtgatgaacttgaaacaaaaacaaggttaacaaactcatatacaaatatt |
2442889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 59 - 191
Target Start/End: Complemental strand, 50984328 - 50984196
Alignment:
| Q |
59 |
gactatcttgctctgcatgcgatagaatgatacaaaatttctagaattgcattgtaaaatggtaatatagaggagccctcgatcaacttctggtaaaca- |
157 |
Q |
| |
|
||||||||||||||||||| || ||| | | ||||||||| |||||||| |||| ||||||||||||||||| ||||||| ||||| |||| | ||||| |
|
|
| T |
50984328 |
gactatcttgctctgcatgtgacagattaaaacaaaatttgtagaattg-attg-aaaatggtaatatagagaagccctcaatcaatttctagaaaacac |
50984231 |
T |
 |
| Q |
158 |
-gtgtcagtgagatgaacttgaaacaaaaacaagg |
191 |
Q |
| |
|
|| ||||||||||||| ||||||||||| ||||| |
|
|
| T |
50984230 |
agtttcagtgagatgaagttgaaacaaaatcaagg |
50984196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 71
Target Start/End: Complemental strand, 34019952 - 34019916
Alignment:
| Q |
35 |
cttctctttttgcaaccattttcagactatcttgctc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34019952 |
cttctctttttgcaaccattttcagactatcttgctc |
34019916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University