View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_374 (Length: 231)
Name: NF11324A_low_374
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_374 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 40 - 231
Target Start/End: Complemental strand, 44256329 - 44256138
Alignment:
| Q |
40 |
aatgattgttataggttgtctaaaaaaccactcgtgtgttttgactcaactatcactttgtagatcaccacatatatgttgcttcctataaacaggattt |
139 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44256329 |
aatgattcttataggttgtctaaaaaaccactcgtgtgttttgactcaactatcagtttgtagatcaccacatatatgttgcttcctataaacaggattt |
44256230 |
T |
|
| Q |
140 |
agacttcatgatgtgggagttgaatttaccatgctgtgtatcaatgtaaccatgttttttacgcaacttttggtaaatcggttagaatggga |
231 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44256229 |
agagttcatgatgtgggagttgaatttaccatgctgtgtatcaatgtaaccatgttttttacgcaacttttggtatatcggttagaatggga |
44256138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 42
Target Start/End: Complemental strand, 44256391 - 44256357
Alignment:
| Q |
8 |
acaattagaccttattagttcattataattataat |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44256391 |
acaattagaccttattagttcattataattataat |
44256357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University