View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_394 (Length: 230)
Name: NF11324A_low_394
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_394 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 230
Target Start/End: Complemental strand, 5924468 - 5924247
Alignment:
| Q |
8 |
ccaaaaactatgcgtcttcgtctttttgtttacaagagctttgtaagattcttgaaaaatgggggtttggtttggccggttttttacgaggttgagcctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5924468 |
ccaaaaactatgcgtcttcgtctttttgtttacaagagctttgtaagattcttgaaaa-tgggggtttggtttggccggttttttatgaggttgagcctt |
5924370 |
T |
|
| Q |
108 |
cgaatgtgaggaagttgagtgggagttttggagaagctatgtctgttcatgaggttagggatagtgatgatgttgataggttggagaaatggaagaaggg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5924369 |
cgaatgtgaggaagttgagtgggagttttggagaagctatggctgttcatgaggttaggtatagtgatgatgttgataggttggagaaatggaagaaggg |
5924270 |
T |
|
| Q |
208 |
tctttaccaagttgctaatttag |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5924269 |
tctttaccaagttgctaatttag |
5924247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University