View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_399 (Length: 230)
Name: NF11324A_low_399
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_399 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 4585099 - 4584873
Alignment:
| Q |
7 |
agatttggcatagattttcatagagttgttt-agttatgcaatcttttcattgtattt-atactattttcagtattagggat-atcaagctttcagattt |
103 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4585099 |
agatttggcataaattttcatagagttgttttagttatgcaatcttttcattgtattttataccgttttcagtattagggattatcaagctttcagattt |
4585000 |
T |
|
| Q |
104 |
tcattttagttccatttttagtggtatcatgcttttaatttactgacgcggttacattgccaacctttatattacggcaaactgtggatgatacagtcaa |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4584999 |
tcattttagttccatttttactggtatcatgcttttaatttactgacgcggttacattgccaacctttatattacggcaaactgtggacgatacagtcaa |
4584900 |
T |
|
| Q |
204 |
gataactgctgcaatgacgttgcaaag |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4584899 |
gataactgctgcaatgacgttgcaaag |
4584873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University