View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_406 (Length: 230)
Name: NF11324A_low_406
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_406 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
| [»] scaffold0004 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 49 - 230
Target Start/End: Complemental strand, 21626083 - 21625902
Alignment:
| Q |
49 |
ttctaatgtaaaggaaaggaaggatatattggtcgtttttactacccaagttgcatacaccaattggtgagtaatattttcattggagcacaagagagcc |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21626083 |
ttctaatgtaaaggaaaggaaggatatattggtcgttttcactacccaagttgcatacaccaattggtgagtaatattttcattggagcacaagagagcc |
21625984 |
T |
|
| Q |
149 |
aaggaaccgaaattgaaggattgatgcaggacaagagtccttgttggagacagagttttgggtcaagactgcatcaagagga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21625983 |
aaggaaccgaaattgaaggattgatgcaggacaagagtgcttgttggagacagagttttgggtcaagactgcatcaagagga |
21625902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 66 - 113
Target Start/End: Original strand, 21626702 - 21626749
Alignment:
| Q |
66 |
ggaaggatatattggtcgtttttactacccaagttgcatacaccaatt |
113 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21626702 |
ggaaggatatattggtcgttttcactacccaagttgcatacaccaatt |
21626749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 161 - 225
Target Start/End: Original strand, 336284 - 336348
Alignment:
| Q |
161 |
ttgaaggattgatgcaggacaagagtccttgttggagacagagttttgggtcaagactgcatcaa |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
336284 |
ttgaaggattgatgcaggacaagagtccttgttggagacagagttttgggtcaagactgcatcaa |
336348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University