View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_412 (Length: 229)
Name: NF11324A_low_412
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_412 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 48 - 214
Target Start/End: Complemental strand, 33262239 - 33262073
Alignment:
| Q |
48 |
tgaatgacccaaaatcattgagctcagctcttctgaagttgggatgttgaaaggcagacttgctggcccttgcaatgtggcattctgcggttgcaaacta |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33262239 |
tgaatgacccaaaatcattgagctcagctcttctgaaattgggatgttgaaaggcagacttgttggcccttgcagtgtggcattctgcggttgcaaacta |
33262140 |
T |
 |
| Q |
148 |
gtcattgttgacccctccaatatggcagtttgtggttgcagatgactaattgctggcccttccaaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
33262139 |
gtcattgttgacccctccaatatggcagttcgtggttgcagattactaattgatggcccttccaaca |
33262073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University