View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_425 (Length: 227)
Name: NF11324A_low_425
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_425 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 24125305 - 24125247
Alignment:
| Q |
1 |
agtgttcacttttcttattttgaaagttttcaaatgttcttttcagttaggttgcttat |
59 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
24125305 |
agtgttcacttttcttattttgaaagtttccaaatgttcttttcagttagattgcttat |
24125247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 24124471 - 24124424
Alignment:
| Q |
175 |
ttatcttcacagtttggtatgcaatttatgcatggctacggatggtgt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24124471 |
ttatcttcacagtttggtatgcaatttatgcatggctacggatggtgt |
24124424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 84 - 130
Target Start/End: Complemental strand, 24124546 - 24124500
Alignment:
| Q |
84 |
tttggcgactcttgtatcatatctcttctttgttttatatatataat |
130 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24124546 |
tttggcgactcttgtatcgtatctcttctttgttttatatatataat |
24124500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 45163378 - 45163435
Alignment:
| Q |
1 |
agtgttcacttttcttattttgaaagttttcaaatgttcttttcagttaggttgcttat |
59 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||| ||| | ||||||| |
|
|
| T |
45163378 |
agtgttcactttacttattttgaaagttttcaaat-ttcttttcaattacgctgcttat |
45163435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University