View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_428 (Length: 227)
Name: NF11324A_low_428
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_428 |
 | |
|
| [»] scaffold0027 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0027 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 51 - 227
Target Start/End: Complemental strand, 46325 - 46152
Alignment:
| Q |
51 |
tattcatttgaatcggtagataaaatcaagaacaataaaaattttgtgtcattgaaacttaaaagatgaatttgcaactaaatttacatcattgaagtca |
150 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46325 |
tattcatttaaatcggtagataaaatcaacaacaataaaaattttgtgtcattgaaacttaaaagatgaaattgcaactaaatttacatcattgaagtca |
46226 |
T |
|
| Q |
151 |
atatcataaatcggtataataatgcctacaaaaagttacatgattaaagcgatctaaatacgcatttgaatatgtag |
227 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46225 |
atatcataaatcggta---taatgcctacaaaaagttacatgattaaagcgatctaaatacgcatttgaatatgtag |
46152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 160
Target Start/End: Original strand, 51628989 - 51629039
Alignment:
| Q |
110 |
taaaagatgaatttgcaactaaatttacatcattgaagtcaatatcataaa |
160 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||| |||| |||||| |
|
|
| T |
51628989 |
taaaagatgaatttgcaaataaattcacatcatttaagttaatagcataaa |
51629039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University