View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_437 (Length: 225)
Name: NF11324A_low_437
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_437 |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 34 - 206
Target Start/End: Complemental strand, 25802075 - 25801903
Alignment:
| Q |
34 |
gtgttttgggtggctgaaatgggatatctcactgtatttcattgttctgtttcttctctgtttgtttgtgtgatattgcatatgtaatggtaactgttgt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25802075 |
gtgttttgggtggctgaaatgggatatctcactgtatttcattgttctgtttcttctctttttgtttgtgtgatattgcatatgtaatggtaactgttgt |
25801976 |
T |
 |
| Q |
134 |
tatgtatttataattggaaggggcgtgatttggacttgtgctggtttgtgggtaattaggtaatttgaaagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25801975 |
tatgtatttataattggaaggggcatgatttggacttgtgctggtttgagggtaattaggtaatttgaaagtg |
25801903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 34 - 100
Target Start/End: Complemental strand, 25816168 - 25816102
Alignment:
| Q |
34 |
gtgttttgggtggctgaaatgggatatctcactgtatttcattgttctgtttcttctctgtttgttt |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25816168 |
gtgttttgggtggctgaaatgtgatatctcgttgtatttcattgttctgtttcttctctatttgttt |
25816102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 34 - 206
Target Start/End: Original strand, 112456 - 112617
Alignment:
| Q |
34 |
gtgttttgggtggctgaaatgggatatctcactgtatttcattgttctgtttcttctctgtttgtttgtgtgatattgcatatgtaatggtaactgttgt |
133 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112456 |
gtgttttgggtggctgaaatgtgatatctcactgtatttcattgttctg-----------tttgtttgtgtgatattgcatatgtaatggtaactgttgt |
112544 |
T |
 |
| Q |
134 |
tatgtatttataattggaaggggcgtgatttggacttgtgctggtttgtgggtaattaggtaatttgaaagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
112545 |
tatgtatttataattggaaggggcgtgatttggacttgtgttggtttgagggtaattaagtaatttgaaagtg |
112617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University