View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_438 (Length: 225)
Name: NF11324A_low_438
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_438 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 47 - 219
Target Start/End: Complemental strand, 37242558 - 37242385
Alignment:
| Q |
47 |
caacttaccctatgaaaaagcatctttacgcggttaggcttctataaatatatccttcagcacttgtccttttacaccacagttccaaaccctaat-cta |
145 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
37242558 |
caacttaccctatgaaaaagcatatttacgcggttaggcttctataaatatatccttcaacccttgtcctttttcaccacagttccaaaccctaatccta |
37242459 |
T |
|
| Q |
146 |
ctagctcaacgctgcttcagaaacttcatcgtccttcatcaaatttctactatggcttcctacatggttgtgtt |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37242458 |
ctcgctcaacgctgcttcagaaacttcatcgtccttcatcaaatttctactatggcttcctacatggttgtgtt |
37242385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 160 - 209
Target Start/End: Complemental strand, 14351987 - 14351938
Alignment:
| Q |
160 |
cttcagaaacttcatcgtccttcatcaaatttctactatggcttcctaca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14351987 |
cttcagaaacttcatcgtccttcatcaaatttctactgtggcttcctaca |
14351938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University