View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_444 (Length: 223)
Name: NF11324A_low_444
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_444 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 223
Target Start/End: Original strand, 12122166 - 12122382
Alignment:
| Q |
7 |
aagctttctatgaggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatctttc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122166 |
aagctttctatgaggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatctttc |
12122265 |
T |
 |
| Q |
107 |
tggaggcatttccgaatgtaatcttcggaggattgagggtgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtgtaattggagacaa |
206 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122266 |
tggaggcatttccgaatataatcttcggaggattgaggttgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtgtaattggagacaa |
12122365 |
T |
 |
| Q |
207 |
tatcttctaagataagg |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
12122366 |
tatcttctaagataagg |
12122382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 10 - 218
Target Start/End: Original strand, 14691688 - 14691896
Alignment:
| Q |
10 |
ctttctatgaggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatctttctgg |
109 |
Q |
| |
|
|||| |||||||||||||||||| ||| |||||||||| |||||||| || |||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
14691688 |
ctttttatgaggctgccataattgattagtgggacccactgacctcaaaccggagattctaaaccctaatttgatactagaagattctcgatctttctgg |
14691787 |
T |
 |
| Q |
110 |
aggcatttccgaatgtaatcttcggaggattgagggtgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtgtaattggagacaatat |
209 |
Q |
| |
|
||||||||||| ||||||||||| ||||| || |||||||||||||| ||||| ||||||||||||||||| || | ||||||||||||| |||||| | |
|
|
| T |
14691788 |
aggcatttccggatgtaatcttcagaggactgtgggtgccatgttcgtgaaccgatcttgatgtcgacgacggcagggttggtgtaattgctgacaatgt |
14691887 |
T |
 |
| Q |
210 |
cttctaaga |
218 |
Q |
| |
|
||||||||| |
|
|
| T |
14691888 |
cttctaaga |
14691896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University