View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_446 (Length: 222)
Name: NF11324A_low_446
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_446 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 38815606 - 38815446
Alignment:
| Q |
15 |
tgttggaaattttgccttgattgtggtctgcccctagccatcttaaatttggcttttaaatttccttcattgcagcttcgagcaccctaattttgctggg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38815606 |
tgttggaaattttgccttgattgtggtcttcccctagccatcttaaatttggcttttaaatttccttcattgcagcttcgagcaccttaattttgctggg |
38815507 |
T |
|
| Q |
115 |
tgtgagaggctgggttagtcctacacagcctagagatctaaatagccgtgaagggcctctt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815506 |
tgtgagaggctgggttagtcctacacagcctagagatctaaatagccgtgaagggcctctt |
38815446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University