View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_457 (Length: 218)
Name: NF11324A_low_457
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_457 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 16353278 - 16353456
Alignment:
| Q |
20 |
tttggagttccccttcgatgagtcctggaagagttgcggtggctgaacaatatggtatgacgtatggaggacgaagcacgtgtagagggcggttatggag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16353278 |
tttggagttccccttcgatgagtcctggaagagttgcggtggctgaacaatatggtatgacgtatggaggacgaagcacgtgtagagggcggttatggag |
16353377 |
T |
 |
| Q |
120 |
acctctattggatactatcagagagaagtcattcaatagaagtaatgaatccgatttgaaagaatttctttgaagtttg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16353378 |
acctctattggatactatcagagagaagtcattcaatagaagtaatgaatccgatttgaaagaatttctttgaagtttg |
16353456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University