View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_461 (Length: 217)
Name: NF11324A_low_461
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_461 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 11696949 - 11697149
Alignment:
| Q |
1 |
gcaccagatgatgttgtctatgttggcgtatttagtgcttgcagtcatgctggtcttgtcgaggagggtctacaatgtttcaaaagcatgcaatttgagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696949 |
gcaccagatgatgttgtctatgttggcgtatttagtgcttgcagtcatgctggtcttgtcgaggagggtctacaatgtttcaaaagcatgcaatttgagc |
11697048 |
T |
 |
| Q |
101 |
atacgattgaaccaacagttcagcattatggttgcatggtggatctgttgggaagatttgggatgctaaaggaagcctatgaactcataaagagcatgtc |
200 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697049 |
ataagattgaaccaacggttcagcattatggttgcatggtggatctgttgggaagatttgggatgctaaaggaagcctatgaactcataaagagcatgtc |
11697148 |
T |
 |
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
11697149 |
a |
11697149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University