View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_466 (Length: 215)
Name: NF11324A_low_466
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_466 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 54261173 - 54261350
Alignment:
| Q |
18 |
aaatagctaatacataagcgcataagttataattgcaaattaagctgtttatccagatagggcgtatatcttgtgttctcagtattcaaagttcaattgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54261173 |
aaatagctaatacataagcgcataagttataattgcaaattaagctgtttatccatatagggcgtatatcttgtgttctcagtattcaaagttcaattgt |
54261272 |
T |
 |
| Q |
118 |
ttactaatttataagagtaaaggaaattagcaaaagtttgaaagatcaaactcttaattacttgtttcgctctgtgat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54261273 |
ttactaatttataagagtaaaggaaattagcaaaagtttgaaggatcaaactcttaattacttgtttcgctctgtgat |
54261350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University