View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_477 (Length: 210)
Name: NF11324A_low_477
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_477 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 21 - 127
Target Start/End: Complemental strand, 47094433 - 47094327
Alignment:
| Q |
21 |
taacaactatttcaaatgaacaacaaacattctcatcactcatctcacctctattcaacaatggcacccaaaacaaaccactcaaacacgttcatcatct |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47094433 |
taacaactatttcaaatgaacaaaaaacattctcatcactcatctcacctctattcaacaatggcacccaaaacaaaccactcaaacactttcatcatct |
47094334 |
T |
 |
| Q |
121 |
tcttact |
127 |
Q |
| |
|
||||||| |
|
|
| T |
47094333 |
tcttact |
47094327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University