View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_478 (Length: 209)
Name: NF11324A_low_478
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_478 |
 | |
|
| [»] scaffold0026 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 25802219 - 25802411
Alignment:
| Q |
1 |
attttacacaaaatgcacctttcagttcatgcaaattccaccaggaaacacgccgcgttattgcaacgcatgcgaaaaggacgtgaacgggtttgtttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25802219 |
attttacacaaaatgcacctttcagttcatgcaaattccaccaggaaacacgctgcgttattgcaacgcatgcgaaaaggacgtgaacgggtttgtttac |
25802318 |
T |
|
| Q |
101 |
cactgcaaatcctgtgggttcgacctccacccatgttgcgcgaagctgccgatggttcttaacgatggggaaatgaaactttaccttcacagg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25802319 |
cactgcaaatcctgtgggttcgacctccacccatgttgcgcgaagctgccgatggttcttaacgatggggaaatgaaactttaccttcacagg |
25802411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 80 - 144
Target Start/End: Original strand, 25816366 - 25816430
Alignment:
| Q |
80 |
gacgtgaacgggtttgtttaccactgcaaatcctgtgggttcgacctccacccatgttgcgcgaa |
144 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
25816366 |
gacgtgaacgggtttgtataccactgcaaatcatgtggatttgacctccacccatgttgcgcgaa |
25816430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 112312 - 112120
Alignment:
| Q |
1 |
attttacacaaaatgcacctttcagttcatgcaaattccaccaggaaacacgccgcgttattgcaacgcatgcgaaaaggacgtgaacgggtttgtttac |
100 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
112312 |
attttacacaaaatgcaccttccaattcatgcaaatcccaccaggaaacacgccgcattactgcaacgcatgcgaaaaggatgtgaacgggtttgtttac |
112213 |
T |
|
| Q |
101 |
cactgcaaatcctgtgggttcgacctccacccatgttgcgcgaagctgccgatggttcttaacgatggggaaatgaaactttaccttcacagg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
112212 |
cactgcaaatcctgtgggttcgacctccacccgtgttgcgcaaagctgccgatggttcttaacgacggggaaatgaaactttacctttacagg |
112120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University