View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_482 (Length: 207)
Name: NF11324A_low_482
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_482 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 74 - 187
Target Start/End: Complemental strand, 10368784 - 10368671
Alignment:
| Q |
74 |
aggggtgagatcgaaatgcaaacccatacctagaaatagtaacttccttcttcttcttgccgtccttttcaattttcataccactacagcacgggttgtg |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10368784 |
aggggtgagatcgaaatgcaaacccatacctagaaatagtaacttccttcttcttcttgccgtccttttcaattttcataccactacagtacgggttgtg |
10368685 |
T |
|
| Q |
174 |
atgaaggagatgat |
187 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10368684 |
atgaaggagatgat |
10368671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 60
Target Start/End: Complemental strand, 10368873 - 10368838
Alignment:
| Q |
25 |
tatactccacaattgttccttaagacacacacacgc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368873 |
tatactccacaattgttccttaagacacacacacgc |
10368838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 78 - 146
Target Start/End: Complemental strand, 11659653 - 11659585
Alignment:
| Q |
78 |
gtgagatcgaaatgcaaacccatacctagaaatagtaacttccttcttcttcttgccgtccttttcaat |
146 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| | |||||||| ||||||| |||||||||||| |
|
|
| T |
11659653 |
gtgagatcgaaatgcaaacccataccttgaaatagtagcctccttcttgttcttgctgtccttttcaat |
11659585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 78 - 146
Target Start/End: Complemental strand, 11668822 - 11668754
Alignment:
| Q |
78 |
gtgagatcgaaatgcaaacccatacctagaaatagtaacttccttcttcttcttgccgtccttttcaat |
146 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| | ||||||||||| |||| |||||||||||| |
|
|
| T |
11668822 |
gtgagatcgaaatgcaaaccgataccttgaaatagtagcctccttcttctttttgctgtccttttcaat |
11668754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 53239290 - 53239215
Alignment:
| Q |
108 |
aatagtaacttccttcttcttcttgccgtccttttcaattttcataccactacagcacgggttgtgatgaaggaga |
183 |
Q |
| |
|
||||||| |||| ||||||||||||| ||||||||||||||||| |||||| |||| | ||||| |||||||||| |
|
|
| T |
53239290 |
aatagtagcttctttcttcttcttgctgtccttttcaattttcagaccactgcagcgctggttgcaatgaaggaga |
53239215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 2170405 - 2170330
Alignment:
| Q |
108 |
aatagtaacttccttcttcttcttgccgtccttttcaattttcataccactacagcacgggttgtgatgaaggaga |
183 |
Q |
| |
|
||||||| |||| ||||||||||||| ||||||||||||||||| |||||| |||| | ||||| |||||||||| |
|
|
| T |
2170405 |
aatagtagcttctttcttcttcttgctgtccttttcaattttcagaccactgcagcgctggttgcaatgaaggaga |
2170330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University