View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_483 (Length: 207)
Name: NF11324A_low_483
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_483 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 34431689 - 34431517
Alignment:
| Q |
19 |
agtagtacttgtgattcagtggagggccgtagtgtcagtgattcattatcatcctcatcagagtattgcttgtttctatatgcttggaaggttgaatgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34431689 |
agtagtacttgtgattcagtggagggccgtagtgtcagtgattcattatcatcctcatcagagtattgcttgtttctatatgcttggaaggttgaatgaa |
34431590 |
T |
|
| Q |
119 |
aagtatgtatcatatcatatatctcatccgaatggtgaatttgacagaatcacgataacattataatattgtt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
34431589 |
aagtatgtatcatatcatatatctcatccgaatggtgaatttgacaaaatcacgataacattataattttgtt |
34431517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 73 - 120
Target Start/End: Complemental strand, 43402649 - 43402602
Alignment:
| Q |
73 |
tcatcagagtattgcttgtttctatatgcttggaaggttgaatgaaaa |
120 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43402649 |
tcatcagagttttgcttgtttctttatgcttggaaggttgaatgaaaa |
43402602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University