View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_484 (Length: 207)
Name: NF11324A_low_484
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_484 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 22 - 194
Target Start/End: Complemental strand, 32265903 - 32265731
Alignment:
| Q |
22 |
ctgcatccttcaacctctttacagtcaaataggaattagagtcagaaacatatagtaaagatcagattgttaatggaaggggggatgacatatttttcct |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
32265903 |
ctgcatccttcaacctctttacagtcaaataggaattagagtcagaaacatatagtaaagatcagattgctaatagaaggggggatgacatatttttcct |
32265804 |
T |
|
| Q |
122 |
atgttaaaatggagccaggggaaatttttacatggcccaatcaaacttcctatacagtaatcttgttccaaca |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32265803 |
atgttaaaatggagccaggggaaatttttacatggcccaatcaaacttcctatacagtaatcttgttccaaca |
32265731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University