View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_491 (Length: 206)
Name: NF11324A_low_491
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_491 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 21 - 130
Target Start/End: Complemental strand, 43285539 - 43285430
Alignment:
| Q |
21 |
gatgaatggaaaggtaaaacggggaaggaaagaaggaaaagagggtaaggtagaaaaacatgccttggtgtcagatatacccacgtgaggcctcactgcc |
120 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43285539 |
gatgaatggaaaggtaaaacgaggaaggaaagaaggaaaagagggtaaggtagaaaaacatgccttggtgtcagatatacccacgtgaggcctcactgcc |
43285440 |
T |
 |
| Q |
121 |
acccccatgt |
130 |
Q |
| |
|
|||||||||| |
|
|
| T |
43285439 |
acccccatgt |
43285430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 1250209 - 1250128
Alignment:
| Q |
21 |
gatgaatggaaaggtaaaacggggaaggaaagaaggaaaagagggtaaggtagaaaaacatgccttggtgtcagatataccc |
102 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
1250209 |
gatggatggaaaggtaaaacgaggaaggaaagaaggaaaagagggtaagatagaaaaacatgccttggtgtcagataaaccc |
1250128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University