View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_499 (Length: 201)
Name: NF11324A_low_499
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_499 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 28 - 182
Target Start/End: Complemental strand, 6170472 - 6170318
Alignment:
| Q |
28 |
ctactcaacatgaaatgtggtagagtttgcatctcttggcccagnnnnnnngacaactcataaacagcttctttctcactcgcaccacttctatcaggta |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6170472 |
ctactcaacatgaaatgtggtagagtttgcatctcttgacccagtttttttgacaactcataaacagcttctttctcactcacaccacttctatcaggta |
6170373 |
T |
 |
| Q |
128 |
tagtcctttttgcctgtggaatataacagagnnnnnnngcaagcaattaattcat |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6170372 |
tagtcctttttgcctgtggaatataacagagaaaaaaagcaagcaattaattcat |
6170318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 28 - 182
Target Start/End: Original strand, 35099313 - 35099466
Alignment:
| Q |
28 |
ctactcaacatgaaatgtggtagagtttgcatctcttggcccagnnnnnnngacaactcataaacagcttctttctcactcgcaccacttctatcaggta |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35099313 |
ctactcaacatgaaatgtggtagagtttgcatctcttggcccagtttttttgacaactcataa-cagcttatttctcactcgcaccacttctatcaggta |
35099411 |
T |
 |
| Q |
128 |
tagtcctttttgcctgtggaatataacagagnnnnnnngcaagcaattaattcat |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35099412 |
tagtcctttttgcctgtggaatataacagagaaaaaaagcaagcaattaattcat |
35099466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University