View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_500 (Length: 201)
Name: NF11324A_low_500
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_500 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 36 - 201
Target Start/End: Complemental strand, 31798862 - 31798693
Alignment:
| Q |
36 |
aattgattttaattgctagttcgattgctcagtagaacaattcttgcaagattttgttt--atataattcaagtagnnnnnnnnnn--aataggaattca |
131 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||| |
|
|
| T |
31798862 |
aattgattttaattactagttcgattgctcagtagaacaattcttgcaagattttttttttatataattcaagtagttttttttttttaataggaattca |
31798763 |
T |
|
| Q |
132 |
agtaggcaatttgaagattcaagttcaatcacgaaataatggatggtccatgaaaatcttatgacaaagc |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31798762 |
agtaggcaatttgtagattcaagttcaatcacgaaataatggatggtccatgaaaatcttatgacaaagc |
31798693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University