View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_54 (Length: 401)
Name: NF11324A_low_54
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 217 - 389
Target Start/End: Complemental strand, 43653234 - 43653062
Alignment:
| Q |
217 |
acgcagaaagtaccattcattacagaagatttggaacttgaatgtgaaggaaaggacaaatacaagtgtggttctaatgttttctggaaatggtgaaaat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43653234 |
acgcagaaagtaccattcattacagaagatttggaacttgaatgtgaaggaaaggacaaatacaagtgtggttctaatgttttctggaaatggtgaaaat |
43653135 |
T |
|
| Q |
317 |
tgacaacattttattttcctagtgttgttctctttgaaatgtatcgaacttctccttgataatataccatatt |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43653134 |
tgacaacattttattttcctagtgttgttctctttgaaatgtatcgaacttctccttgataatataccatatt |
43653062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 43653450 - 43653302
Alignment:
| Q |
1 |
agaagaggttagccactagttgagcaaattttgcaagagcatatacagtgcaatttggtacttgcaacttccctgagaatttcactgcttgccaagatct |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||| |
|
|
| T |
43653450 |
agaagaggttagccactagtggagcaaattttgcaagagcatatacagtgcaatttggtacttgcaagttccctgagaatttcaccggttgccaagatct |
43653351 |
T |
|
| Q |
101 |
tgctaaacagaaggtctgactctaaccttaaacaccttttgtttcacta |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43653350 |
tgctaaacagaaggtctgactctaaccttaaacatcttttgtttcacta |
43653302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University