View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_61 (Length: 386)
Name: NF11324A_low_61
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 104 - 365
Target Start/End: Complemental strand, 32344657 - 32344396
Alignment:
| Q |
104 |
ttcttttagttttaattgttaacttttcttgatccagggatgtctatcgacatatgcggaccacatacaccgatgaagagtcacgatgtacgaaataata |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
32344657 |
ttcttttagttttaattgttaacttttcttgatccagggatgtctatcgacatatgcggaccacatacaccgaggaagagtcgcgatgtacgaaataata |
32344558 |
T |
|
| Q |
204 |
caattatagcacatatgagcttttcatgtgaccaaacgatcacccgaccatcgagctataaaggtaaaactgacaaatcctctctaggggttcacaaata |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
32344557 |
caattatagcacatatgagcttttcatgtgaccaaatgatcgcccgaccatcgagctataaaggtaaaactgacaaatcttctttaggggttcacaaata |
32344458 |
T |
|
| Q |
304 |
tagcgttccaaaccgaaatatggtactaactctcatttgagaaatctcttcaaagcacattg |
365 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
32344457 |
tagcgttccacaccgaaatatggtactaactctcatttgaaaagtctcttcaaagcacattg |
32344396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University