View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_85 (Length: 358)
Name: NF11324A_low_85
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 44359225 - 44358883
Alignment:
| Q |
1 |
gcggcagaaatgacttggtgggattcataaaggaaatccatgctcaaggattgtacgtttccctcaggattggacctttcatcgagagtgaatggaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44359225 |
gcggcagaaatgacttggtgggattcataaaggaaatccatgctcaaggattgtacgtttccctcaggattggacctttcatcgagagtgaatggaatta |
44359126 |
T |
|
| Q |
101 |
cgggtactttcactaacttacataaaaatgtactcaattttattcccaattactaagccaaaattgtcatctctaacacataataatgctaactgctaaa |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44359125 |
cgggtagtttcactaacttacataaaaatgtactcaattttattcccaattactaagccaaaattgtcatctctaacacataataatgctaactgctaaa |
44359026 |
T |
|
| Q |
201 |
attgaaggggattcccattttggctacatgatgtccctggtattgtctaccgaacagacaatgagccattcaaggtacatttagctagcatactcttttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44359025 |
attgaaggggattcccattttggctacatgatgtccctggtattgtctaccgaacagacaatgagccattcaaggtacatttagctagcatactcttttg |
44358926 |
T |
|
| Q |
301 |
gccacacttatttgttgtgttacgttaatactaacatgtctat |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44358925 |
gccacacttatttgttgtgttacgttaatactaacatgtctat |
44358883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University