View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324A_low_99 (Length: 345)
Name: NF11324A_low_99
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324A_low_99 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 203 - 327
Target Start/End: Complemental strand, 5402076 - 5401952
Alignment:
| Q |
203 |
tcccctgcatattcattcatgtatatttttcatctaaatacaaaataattatgatgattttatttaggtccatcgattctggatgtgaaacagatgtttt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402076 |
tcccctgcatattcattcatgtatatttttcatctaaatacaaaataattatgatgattttatttaggtccatcgattctggatgtgaaacagatgtttt |
5401977 |
T |
|
| Q |
303 |
gatacgtgtagaaggaacctgtttt |
327 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5401976 |
gatacgtgtagaaggaacctgtttt |
5401952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 10 - 68
Target Start/End: Complemental strand, 5402274 - 5402216
Alignment:
| Q |
10 |
aaatgaagggttggaaccaaattggtatcattgaaaccatttacgaggaagaacgtgaa |
68 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5402274 |
aaatgaagggttggaaccaaattggtgtcattgaaaccatttacgaggaagaacgtgaa |
5402216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University