View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324_high_6 (Length: 235)
Name: NF11324_high_6
Description: NF11324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324_high_6 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 81 - 218
Target Start/End: Complemental strand, 30775596 - 30775459
Alignment:
| Q |
81 |
aaaatcttcaaaccatttcttgaggtaatccttgaagctgcagcatacatttgaccgtccgagaaagatatatgccaacttacttgagtgtctacccttg |
180 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| | |||| |||||||| ||| ||||||||||||||||| |||||||| || |||||| |
|
|
| T |
30775596 |
aaaatcttcaaactatttcttgaggtaatctttgaagctgcaacgtacaattgaccgtgtgaggaagatatatgccaacttgcttgagtgactgcccttg |
30775497 |
T |
 |
| Q |
181 |
atttttgttgatgatcattgcaaaacaaacatctatag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30775496 |
atttttgttgatgatcattgcaaaacaaacatctatag |
30775459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 30775832 - 30775773
Alignment:
| Q |
19 |
ttggatggtatcactatttctaataaaatttgttaggatggctttgatatttggtatcta |
78 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30775832 |
ttggatggtatcactatttctaataaattttgttaggatggctttgatatttggtatcta |
30775773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 217
Target Start/End: Original strand, 79366 - 79438
Alignment:
| Q |
145 |
aagatatatgccaacttacttgagtgtctacccttgatttttgttgatgatcattgcaaaacaaacatctata |
217 |
Q |
| |
|
|||||||||| |||||| ||||||| || ||||||| ||||||| || ||||||||||||| ||| ||||| |
|
|
| T |
79366 |
aagatatatgtcaacttgtttgagtgactgcccttgacttttgttcatagtcattgcaaaacatacaactata |
79438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University