View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324_low_6 (Length: 240)
Name: NF11324_low_6
Description: NF11324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 34857534 - 34857758
Alignment:
| Q |
1 |
taattacaatacaggccacaggtaagcatagagcatattgtacttgtggcccatattgcaagaaaaaacatatttagcaaagacaatgcaacgcataagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34857534 |
taattacaatacaggccacaggtaagcatagagcatattgtacttgtggcccatattgcaagaaaaaacatatttagcaaagacaatgcaacacataagt |
34857633 |
T |
|
| Q |
101 |
atctctaaccaagctagtttgcaattatgatcacatctataattcgcaggtattggcttgaatagaagtctttactctttagtctacctttggctgcaat |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34857634 |
atctctaaccaagctagcttgcaattatgatcacatctataattcgcaggtattggcttgaatacaagtctttactctttagtctacctttggctgcaat |
34857733 |
T |
|
| Q |
201 |
atcttttgactatcactgaaatatt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34857734 |
atcttttgactatcactgaaatatt |
34857758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University