View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11324_low_7 (Length: 235)

Name: NF11324_low_7
Description: NF11324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11324_low_7
NF11324_low_7
[»] chr6 (2 HSPs)
chr6 (81-218)||(30775459-30775596)
chr6 (19-78)||(30775773-30775832)
[»] scaffold0007 (1 HSPs)
scaffold0007 (145-217)||(79366-79438)


Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 81 - 218
Target Start/End: Complemental strand, 30775596 - 30775459
Alignment:
81 aaaatcttcaaaccatttcttgaggtaatccttgaagctgcagcatacatttgaccgtccgagaaagatatatgccaacttacttgagtgtctacccttg 180  Q
    ||||||||||||| |||||||||||||||| ||||||||||| | |||| ||||||||  ||| ||||||||||||||||| |||||||| || ||||||    
30775596 aaaatcttcaaactatttcttgaggtaatctttgaagctgcaacgtacaattgaccgtgtgaggaagatatatgccaacttgcttgagtgactgcccttg 30775497  T
181 atttttgttgatgatcattgcaaaacaaacatctatag 218  Q
    ||||||||||||||||||||||||||||||||||||||    
30775496 atttttgttgatgatcattgcaaaacaaacatctatag 30775459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 30775832 - 30775773
Alignment:
19 ttggatggtatcactatttctaataaaatttgttaggatggctttgatatttggtatcta 78  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
30775832 ttggatggtatcactatttctaataaattttgttaggatggctttgatatttggtatcta 30775773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 217
Target Start/End: Original strand, 79366 - 79438
Alignment:
145 aagatatatgccaacttacttgagtgtctacccttgatttttgttgatgatcattgcaaaacaaacatctata 217  Q
    |||||||||| ||||||  ||||||| || ||||||| ||||||| ||  ||||||||||||| ||| |||||    
79366 aagatatatgtcaacttgtttgagtgactgcccttgacttttgttcatagtcattgcaaaacatacaactata 79438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University