View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11324_low_8 (Length: 222)
Name: NF11324_low_8
Description: NF11324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11324_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 10 - 206
Target Start/End: Original strand, 55523222 - 55523418
Alignment:
| Q |
10 |
agcaaaggttcaaagaaatggtagcaagcaaaggtttagagtttgctcagtctgaaatcaatgacttgaattgggaaagcactttctttttgcgccacct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55523222 |
agcaaaggttcaaagaaatggtagcaagcaaaggtttagagtttgctcagtctgaaattaatgacttggattgggaaagcactttctttttgcgccacct |
55523321 |
T |
 |
| Q |
110 |
tcctaactctaacatatcagagatccctgatcttgatcatgactacaggtcattatttattctcaatataaatcatgcacgtctcttattttaaatt |
206 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55523322 |
tcctaactttaacatatcagagatccctgatcttgatcatgactacaggtcattatttattctcaatataaatcacgcacgtctcttattttaaatt |
55523418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 12 - 161
Target Start/End: Original strand, 8926477 - 8926626
Alignment:
| Q |
12 |
caaaggttcaaagaaatggtagcaagcaaaggtttagagtttgctcagtctgaaatcaatgacttgaattgggaaagcactttctttttgcgccaccttc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| || |||||| ||||| ||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
8926477 |
caaaggttcaaagaaatggtagcaagcaaaggtttggagtgtgttcagtcagaaataaatgatttggattgggaaagcactttctttttgcgccatcttc |
8926576 |
T |
 |
| Q |
112 |
ctaactctaacatatcagagatccctgatcttgatcatgactacaggtca |
161 |
Q |
| |
|
|| ||||| || ||||||||||| ||||||||| | || ||||||||| |
|
|
| T |
8926577 |
cttcttctaatatttcagagatcccagatcttgatgaagattacaggtca |
8926626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University