View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11326_low_3 (Length: 358)
Name: NF11326_low_3
Description: NF11326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11326_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 5e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 28 - 183
Target Start/End: Complemental strand, 10582095 - 10581941
Alignment:
| Q |
28 |
gttctaagataaatattgatgaatattcagaatttattaagaagactaga-tgaagaatgcatattttagtagatcaagtccttcgattgaagaatacaa |
126 |
Q |
| |
|
||||||||||||||||||||||||||||| | | | ||| |||| ||| ||||||| |||||||||||||||||||||||| || |||||||| ||| |
|
|
| T |
10582095 |
gttctaagataaatattgatgaatattcacagtgcttgaag-agac-agagcgaagaatacatattttagtagatcaagtcctttgagtgaagaatgcaa |
10581998 |
T |
|
| Q |
127 |
aatctctctgcaaggagaggtctagatgtagcaacaagttgttttgagttagtataa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
10581997 |
aatctctctgcaaggagaggtctagatgtagcaaaaatttgttttgagttagtataa |
10581941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 256 - 339
Target Start/End: Complemental strand, 10581869 - 10581786
Alignment:
| Q |
256 |
ctttaatcaaacatttttagggaatgagaaatctttgataaagctcattttcttgtgttgccaataccttcagaaagttgtata |
339 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10581869 |
ctttaaacagacatttttagggaatgagaaatctttgataaagctcattttcttgtgttgccaataccttcagaaagttgtata |
10581786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University