View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11327_low_2 (Length: 894)
Name: NF11327_low_2
Description: NF11327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11327_low_2 |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0025 (Bit Score: 45; Significance: 4e-16; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 398 - 461
Target Start/End: Original strand, 149635 - 149696
Alignment:
| Q |
398 |
atcacgccgtgtttgaacttcacattcaagaaactctctctttcgttgcttttccctggattta |
461 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
149635 |
atcacgccgtgtttgaacttcacattcatgaaa--ctctctttcgttgctcttccctggattta |
149696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 398 - 461
Target Start/End: Complemental strand, 13112533 - 13112472
Alignment:
| Q |
398 |
atcacgccgtgtttgaacttcacattcaagaaactctctctttcgttgcttttccctggattta |
461 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| | ||||||||||||| |
|
|
| T |
13112533 |
atcacgtcgtgtttgaacttcacattcaagaaact--ctctttcgttgttcttccctggattta |
13112472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University