View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11327_low_6 (Length: 418)
Name: NF11327_low_6
Description: NF11327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11327_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 22 - 408
Target Start/End: Complemental strand, 35677793 - 35677407
Alignment:
| Q |
22 |
gatgatagttttttgttagaactttgtcggttcaagcatggtggcgagtctttatcaaaacttggtgatcttggtagatatctatgccagattgcttagc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35677793 |
gatgatagttttttgttagaactttgtcggctcaagcatggtggcgagtctttatcaaaacttggtgatcttggtagatatctatgccagattccttagc |
35677694 |
T |
|
| Q |
122 |
ttgccttagttatttatgatatatgaatgtttgtgtgatttcttattattgctatttgattgtaatcgaaaggacaatgtcaattatttgtgcatccgga |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35677693 |
ttgccttagttatttatgatctatgaatgtttttgtgatttcttattattgctatttgattgtaatcgaaaggacaatgtcaagtatttgtgcatccgga |
35677594 |
T |
|
| Q |
222 |
atcggaaggaaagattttggagattgcatctcaacttggtaacaagacaggtgtgttcggttttattttgtcatgcagcacctgcttaatgtgattgatt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35677593 |
atcggaaggaaagattttggagattgcatctcaacttggtaaaaagacaggtgtgttcggttttattttgtcatgcagcacctgcttaatgtgattgatt |
35677494 |
T |
|
| Q |
322 |
tcaaagaaaatcctaaataagagtaaaactctatgaaaaattgcttggacatcatatctgaatttttcattgtaggtttggcctttg |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35677493 |
tcaaagaaaatcctaaataagagtaaaactctatgaaaaattgcttggacatcatatctgaatttttcattgtaggtttggcctttg |
35677407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University