View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11328_high_12 (Length: 308)
Name: NF11328_high_12
Description: NF11328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11328_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 82 - 180
Target Start/End: Complemental strand, 33757080 - 33756982
Alignment:
| Q |
82 |
ggttgtgattgtttcacgcatatatggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataactaactttcacggc |
180 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33757080 |
ggttgtgattgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataacaaactttcacggc |
33756982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 88
Target Start/End: Original strand, 963167 - 963251
Alignment:
| Q |
4 |
tggactaatcaaggtaatatttgttccaaacaggttgcagaatatggagaagaaggagaagttgttggagtgataaggggttgtg |
88 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
963167 |
tggactaatcaatgtaatatttgttccaaacaggttgcagaatatgaagaagaaggagaagttgctggagtgataaggggttgtg |
963251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University