View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11329_high_8 (Length: 360)
Name: NF11329_high_8
Description: NF11329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11329_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 20 - 336
Target Start/End: Complemental strand, 49375724 - 49375409
Alignment:
| Q |
20 |
gtgtggttttgccttgaacgtgcactctgtgttgtttaaactttagaaaatgcagtgtgagatgagcaaaacacacgttgcttggtatgggatgagaaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49375724 |
gtgtggttttgccttgaacgtgcactctgtattgtttaaagtttagaaaatgcagtgtgagatgagcaaaacacacgttgcttggtatgggatgagaaag |
49375625 |
T |
 |
| Q |
120 |
aaattttagggctctttcaaatagtgaatgagaaaaataggagtatggtatgagttaggatgttggcgtgggaaataaaaatggggtgtatttagcagtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49375624 |
aaattttagggctctttcaaatagtgaatgagaaaaataggagtatggtatgagttaggatgttggcgtgggaaataaaaatggggtgtatttagcagtg |
49375525 |
T |
 |
| Q |
220 |
catgtagaaaattgcaaagaaaaaagtttgttaactttgggcttcaatcgagaacagaaacagaactagtcgtccacagccacttctcaacggcatttat |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
49375524 |
catgtagaaaattgcaaagaaaaaagtttgttaactttgggcttcaatcgagaacagaaacaggactagtcatccatagccacttctcaacggcatttat |
49375425 |
T |
 |
| Q |
320 |
agaagactgttactttt |
336 |
Q |
| |
|
| |||||| |||||||| |
|
|
| T |
49375424 |
a-aagactattactttt |
49375409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University